There really is a wide selection of effects to choose from, 60 in all, and you can add more. Audio Hijack Pro also lets you enter metadata, although it all has to be done manually (I didn't see an import feature), which is a little tedious. If you are a podcast or audio expert and stumble upon this post, please get in touch if you know how to do more elaborate routing of audio like I’m describing.You can schedule automatic recording at precise days and hours of the week for each application. Note that you could pipe in any audio to skype (music, for example). Local mics are now recorded to separate files, while being combined and sent to Skype as one input through Soundflower. UPDATE: The local mic limitation can be overcome with Audio Hijack Pro, and is what I use now. My desire for a simple and mobile setup makes me want to do this as much as possible through software, and not through mixers and extra hardware, because then the podcasting setup is more portable. However, I’d love to have an efficient setup for any number of local mics (within reason) recorded on separate tracks, but aggregated and sent to the guests. It will record hosts on one channel and the remote guests on another. This setup works great for one local mic being sent to guests. I am wondering if using a bus and customized output settings, I might be able to send a consolidated mix from Logic into Facetime, but I’m not nearly experienced enough to know how to do that. This is a puzzle I need to solve because I’d like to route in multiple mic inputs into Facetime so that David and I can use separate mics, but without introducing some kind of mixer middle-man into this, I’m not sure how to do that. Note that Facetime/Google+ Hangouts will only send Input 1 (our host mic), but not Input 2 (the second channel of my Mackie, for example). In Google Hangouts, click on the gear icon and ensure that you’re using the correct mic input. In Facetime, I just use the Video menu to choose which mic the guest will hear. The last step is to ensure that whatever I’m using to call my guest uses the host mic as input. So, in my example, to capture my voice I’d use Input 1 on the first track, and set the second track to use Input 3 to capture guest audio. Now, in Logic I can choose my aggregate device (now called Podcast Input) as the input device, and then set each track to use the appropriate input. I use a Mackie Onyx Satellite 2-channel firewire device (it’s now discontinued). If you hooked up a firewire/usb device you could choose it instead of the built-in mic for better quality. You can rename the device by double clicking the title. The above screenshot shows an Aggregate device that includes my computer’s built-in mic and Soundflower. This is accomplished in OS X’s Audio/Midi utility: The last step is to partially fulfill #3 from my list above: I want hosts to be recorded separately from my guest, so I need to setup a virtual audio device that includes both my mic and Soundflower guest input, and then set my audio app to use that as input. I could use this to, for example, record internet audio streams. Now I can go to any audio app and set my input as Soundflower to record any sounds that the system is making. I do this by setting my System “output” to Soundflower (thus any sound that OS X makes will be piped into Soundflower): Using Soundflower, I can route OS X system output into any other app I’d like. The secret sauce that makes it possible to capture and route system audio is a freeware utility for OS X called Soundflower. I’ve got hosts (David and me) on one input and the guest audio on another input into Logic Pro X. In my alpha setup, I’ve totally nailed #1 and #2, but have not completely nailed #3.
0 Comments
AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCIGGCACGACAGGITTCC CGACIGGAAAGCGGGCAGTGAGCGCMACGCAATTAATGEGAGTTAGCTCACTCATTAGGCACCCCAGGCITTA CACTITATGCITCCGGCTCGTATGTTGTGTGGAR AGCGGATAACAATTTCACACAGGNANCAGCTATG ACCATGATTACGCCAAGCTATTTAGGEGACACT GAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCT CGGATCCACTAGTAACGOC GTGCTGG CAGATATCC CACACTGGCGGCCGCTCGNGCA TGCATCEAGAGGGOCCAATTCGCCCTATAG GAGTCGTATTACAATTCACIGGCCGTCGETTTACAACGTCGT GACTGGGAAAACCCTGGCGT TTAAT cccc GCTGGCGTAATA GCGAAGAGGCCCGCACCGATCGCCCIICCCAAC GCGCAGCCTATACGTACGGCAGITTMAGGTTTACAC CTATAMAAGAGAGAGCCGTT. Remember the more facts you can discern from the sequence the more points you get. For example, your sequence analysis can contain the location of enzyme digestion sites, the number and size of any open reading frames, the identity of any sequence elements and genes and possibly a map of the DNA with the sequence elements identified. Points will be awarded based on how extensive your interpretation is. Characterize the sequence using Serial Cloner or any other sequence analysis software you chose. There’s a ton of molecular biology softwares out there, so make sure you do your research to find the designer that has the most features you’ll need all in one place.Below is a sequence of DNA. This is a great perk and a real time saver. Direct OrderingĪfter your DNA design is finally complete comes the challenge of checking out the synthesis sites and “shopping around”… unless you choose a software that has an ordering feature embedded within it. Make sure the software you choose codon optimizes your design to avoid this “traffic jam” in translation! 10. Too many codons leads to an oversaturation of ribosomes bound to the mRNA in your system. Virtually running a digest on your sequence and simulating the resulting fragments allows you to judge whether or not your gene is in correct orientation for cloning, avoiding errors and saving you time. Look for a software that has embedded emerging technology such as the RBS Calculator to ensure that your design can be completed as quickly and stress-free as possible. Time Saving ToolsĮven though molecular biology software makes DNA design much simpler than it used to be, there are still some tasks that can be tedious and time consuming. Track ChangesĪ necessary feature if you plan on editing your sequence as you go (which most researchers do). Make sure you choose a program that makes this act simple, with organized libraries that you can easily share with others. One of the best things about genetic engineering going digital is the ease with which you can collaborate with other researchers. The best programs will let you easily import many different file formats and databases such as NCBI. File Importįor the times when you’re not starting your project completely from scratch, it’s necessary that a program allows you to import files from elsewhere on the web or saved on your computer. These libraries allow you to store your primers, keep an updated inventory, easily share with others and automatically attach primers to sequences you’re working on (annealing primers). A good software will have features like auto design, cloning, and sequencing primers, as well as a primer library for storing and reusing primers you have previously designed. Primer DesignĮvery molecular biologist understands the importance of primers for successful DNA amplification. It will make your life much easier down the line. Sequence annotation is crucial as a project progresses, so make sure that the software has a simple, organized annotation form. It’s great if there is both a manual and auto annotation option so you can choose whichever fits your needs for a specific sequence. Sequence AnnotationĪny good software for designing DNA should allow users to annotate their sequences. Cloning wizards make the process extremely easy simply drag and drop your vector and gene of choice in the wizard, and you can visualize the cloning process. Look for programs with good cloning tools and a choice of methods with which to clone your sequence. This follows the trend of seeking molecular biology software programs that allow you to perform the widest variety of tasks in one place. Here are the ten things you should look for when choosing a DNA design program, whether you end up using Genome Compiler or otherwise. The Gibson Assembly Primer Design Tool (GAP Tool) is a free online tool developed to assist in designing primers for the assembly of DNA fragments. While it is very useful, I thought, “wouldn’t it be easier if ONE program could do many of these tasks!?” Luckily, in the time since that list was published, new software has been developed that does! My favorite, Genome Compiler, is an excellent, free program that encompasses many of the features mentioned in the previous list, and will satisfy most of your molecular biology software needs. I recently stumbled upon this list of molecular biology software tools. Some bars and pubs, especially those that form part of a large chain, may arrange for staff to work towards relevant qualifications. Throughout TABCs history, great leaders and public servants have dedicated their careers to protecting public health and safety while supporting businesses. Many employers will look for applicants with previous experience of bar work, however, training for bar work is often done on the job. Total Wine & More was named Retailer of the Year multiple times by various magazines in 2004, 2006, 20. Today, the chain has reached nearly 200 stores, at which 7,000 employees are currently working. It was founded by the Trone brothers in 1991 in Claymont, Delaware. Ideally, the bartender will have strong communication skills, numeracy and physical stamina, as well as the ability to work well within a team and calmness under pressure. Total Wine & More is an American alcohol retailer chain. Bartenders therefore need to be flexible with their working hours. Discover why Total Wine & More is the best company for you. New Total Wine And More jobs added daily. Join the team at Total Wine & More Check out the latest job openings, salaries, remote jobs and more. Leverage your professional network, and get hired. Shifts tend to be long and often include evenings and weekends. Today’s top 75 Total Wine And More jobs in Washington DC-Baltimore Area. The main responsibilities of the bartender include serving drinks and snacks, collecting payments from customers, restocking the bar, and washing and drying glasses. Strong product and service knowledge is required to effectively prepare cocktails and advise customers on drink selections. Shop online for delivery, curbside or in-store pick up. As a Cashier, you play an essential role in the customer. With the increase in consumer sophistication, there is more demand for bartenders who are skilled in the art of mixing drinks, sometimes known as mixologists. Over 8,000 wines, 3,000 spirits & 2,500 beers with the best prices, selection and service at Total Wine & More. Participate in wine, spirits, and beer training to become familiar with Total Wine & More’s products. Bartenders serve drinks and snacks in bars, clubs, hotels, and other licensed premises. Owned by the non-profit organization VideoLAN. VLC is a free and open source cross-platform multimedia player and framework. In Windows, It also allows you to find codecs, play damaged files or a file being downloaded. Windows XP: Click Add or Remove Programs. It supports various file formats including AVI, MP4, MKV, FLV, WMV, MOV, etc. Feel free to add your own Internet radio URLs if you have a few that aren. On the Start menu (for Windows 8, right-click the screens bottom-left corner), click Control Panel, and then, under Programs, do one of the following: Windows Vista/7/8/10: Click Uninstall a Program. The best alternative is VLC Media Player, which is both free and Open Source. I’m not sure how many people still use software-based Internet streams, especially with the popularity of services like Pandora and Songza, but GOM Audio has a list of streaming radios in case your own playlists have grown stale or you want to discover some new music. VLC Media Player Free Open Source Mac Windows Linux Android iPhone Chrome OS Windows S Android Tablet BSD Windows Phone iPad Apple Watch Apple TV Kindle Fire Haiku Xbox Some of the best Windows Music players like GOM Player, Winamp, etc., can significantly improve the music listening experience. There are more than 100 alternatives to GOM Player for a variety of platforms, including Windows, Mac, Linux, Android and BSD. After dropping the Kenny Cortez IV laceless 'house shoes,' K-Dot is ready to lace back up. In simplest terms, he wants us to know that he is human and goes through things too. The React Element 55 began its own legacy as an understated take on the Element 87, and now its new special iteration, a collaboration with Kendrick Lamar, takes over the stage. UPDATE: on October 29th, the Instagram account of Dianne Garcia, Kendrick Lamars and SZAs stylist, posted a clear unofficial picture of the Nike React. Gang members or terrorists et cetera et cetera. You overnight the big rifles then tell Fox to be scared of us. This album feels like a session where Kendrick unapologetically puts everything that’s been on his mind in the past 5 years on the table. It’s nasty when you set us up then roll the dice then bet us up. He mentions on the album how his wife (Whitney Alford) suggested that he go to therapy. He takes maybe his biggest risk of the album on the song ‘Auntie Diaries’ where he tackles his own past homophobia and lobbies for the love and respect of the trans community. He breaks down generational trauma on the song ‘Mother I Sober.’ The Compton MC expresses the difficulties of not being able to please everybody on the track ‘Crown.’ Assisted by actress Taylour Paige, Lamar gives Future a run for his money on the toxic track ‘We Cry Together’ that reminds us of cult-classic Baby Boy. About Press Copyright Contact us Creators Advertise Developers Terms Privacy Policy & Safety How YouTube works Test new features NFL Sunday Ticket Press Copyright. Following up his four Cortez Kenny models, the futuristic React Element 55 sports a marbled colorway reminiscent of Lamar’s Reebok Club C from back when he was collaborating with Reebok. On ‘Father Time,’ Kendrick unpacks the issues that he’s dealt with but never verbalized regarding his father. The Kendrick Lamar x Nike React Element 55 is a special collaboration imagined by the Grammy Award-winning rapper. The album feels like a rollercoaster of emotions as Kendrick spills himself for the public to hear. TikTok Downloader is the same as the other video downloaders but it has something different as it’s a chrome extension that would only work if you have chrome installed on your PC. Copy the link of your favorite video from the TikTok app and paste it on the browser and the video will be saved on your mobile phone. You can download a video and convert it into any format that is compatible with the tool. TTDown is a TikTok video downloader with an amazing interface and conversion tools. The process is the same as the other web apps, simply copy and paste the link on the browser window and let the app do the wonders for you. It doesn’t matter which OS you are using, be it Linux or iOS you just need to have a browser on your device and you can download any TikTok video with just a simple link. The best part about this web app is that it’s simple as making coffee, you just need the correct URL to browse the site, and the rest of everything will be done by the tool itself.ĭownloaderi is a great app to download TikTok videos in a high-quality format without a watermark. You can download TikTok videos without a watermark by only pasting the link on the website and the rest of the website will take care of your videos. TTdownloader is another web app that can download any TikTok video with just a simple link. You don’t require to download any app for it, just simply browse the website and paste the video link to get started with your favorite videos. One can not only download TikTok songs and videos but stories and other videos from Facebook, Instagram, Twitter, Vimeo, and like an app. After that, you will see a browser icon in the bottom, click it and it will redirect you to the ssstiktok.io website and here you can paste the link and your video will be downloaded in no time.ĮxpertsPHP is an online TikTok video downloader that is compatible with all the browsers and social media platforms. There is only a task that you might have to do if you are an iOS user, you need to download the Documents by Readle app from the app store and then copy-paste the video link directly from the TikTok app and launch the Readle app. You can download any TikTok song or video in HD format without any watermark. SSSTikTok is a great app as it's available on all platforms like browser, Android, and iOS. Like the other best apps, it also works on the web app and requires no installation, just browse the website and enter the video link that you want to download, rest the tool will do. Musically Down is a free TikTok video downloading app that would download any video on TikTok within seconds? Be it the music or the video it can download everything from TikTok without any watermark. Put the video link on the search box and let the app show you the magic with a video without a watermark. All it takes is a browser and the video link that you want to download. The best part about this app is the interface that doesn’t ask you to download any app or put some money in the app to download TikTok videos. SnapTik app is claimed to be the best TikTok video downloading app without a watermark. In this guide, you will get to know about some TikTok video downloaders that you can use to download TikTok videos online without watermarks and copyrights. Bonus Tip – Watch TikTok Videos in Reverse Using Wondershare Filmora. Suspected of his murder, Lara goes on the run. She wakes to find Von Croy dead and her memories of the attack blurred. During an argument between Lara and Von Croy, an unknown force attacks them, and Lara is knocked unconscious. The city, and Von Croy, are gripped with fear over a serial killer the press has dubbed the "Monstrum". An unspecified time later, Lara arrives in Paris at the request of her former mentor, Werner Von Croy, who was tasked by a man named Eckhardt to find a set of artefacts known as the Obscura Paintings. The Angel of Darkness follows on from events in Tomb Raider: The Last Revelation and Tomb Raider Chronicles, where Lara Croft was presumed dead. He features mainly identical moves to Lara, and his sections of the game are more based around combat. Initially appearing to be an antagonist, he becomes controllable by the player late in the game. The game also features a second playable character, Kurtis Trent. The game incorporates elements similar to a role-playing game, whereby Lara can talk with various NPCs encountered throughout the environment and choose what kinds of answers to give: early in the game, these answers will directly affect her progress through the story. These actions are also necessary to progress through many of the levels. The rate at which the meter decrease slows if the player performs special actions that increase Lara's strength. Unlike previous games in the series, Lara has a stamina meter that depletes while she is performing bouts of climbing: if the bar empties before reaching her destination, she falls. Her weapons arsenal is also modified from previous games, featuring new weapons such as a K2 Impactor stun gun and upgraded versions of weapons like the shotgun. Lara's ability to sprint, present in the three previous entries in the series, is only available when the player opens a cabinet containing gas masks in the 'Galleries Under Siege' level. Lara can also sneak up on enemies and perform stealth attacks, flatten herself against walls and peer around corners. Her new moves include a small hop, army-crawling, hand-to-hand combat and a "super-jump" that can be performed while running. The majority of Lara's basic moves are carried over from the previous instalment, such as walking, jumping, climbing, swimming, crawling, swinging on ropes and standard gunplay. Players control the main series protagonist Lara Croft throughout the majority of the game. Tomb Raider: The Angel of Darkness, like previous Tomb Raider games, is a third-person action-adventure puzzle game. In the aftermath of the game's release, the planned trilogy of games was scrapped, and the development of the franchise was transferred to Crystal Dynamics for the next entry in the series, Tomb Raider: Legend (2006). However, development was fraught with difficulties, which led to the game being delayed twice and numerous planned sections of the game were scaled back in order to meet deadlines.ĭespite selling 2.5 million copies worldwide, Tomb Raider: The Angel of Darkness received generally negative reviews from critics while some praise went to its narrative, critics faulted the game for its poor controls, camera and numerous technical issues. It was also planned to be the first in a new trilogy of Tomb Raider games released for the new generation. The intention was to create a different game from previous entries in the franchise, one that could compete better with newer action games and fully exploit the potential of the sixth generation of gaming platforms. The game's development began three years before its release. The gameplay follows series tradition, with Lara navigating platforming environments while incorporating stealth and character growth elements. Acting as a direct sequel to Tomb Raider: The Last Revelation and Tomb Raider Chronicles, the storyline follows Lara Croft as she attempts to clear herself of being the suspect of her former mentor Werner Von Croy's murder while investigating the activities of a black magic cult. A Mac OS X port was developed by Beenox and published by Aspyr the same year. Tomb Raider: The Angel of Darkness is a 2003 action-adventure game developed by Core Design and published by Eidos Interactive for PlayStation 2 and Microsoft Windows. His New York venture was to have enormous impact on the cooking of the Chinese diaspora. "The original General Tso's chicken was Hunanese in taste and made without sugar," he says, "but when I began cooking for non-Hunanese people in the United States, I altered the recipe." In the late 1980s, having made his fortune, he sold up and returned to Taipei. Peng Chang-kuei was no hidebound traditionalist, and, faced with new circumstances and new customers, he worked creatively, inventing new dishes and adapting old ones. It was he who brought Hunanese food to public notice." In his office in Taipei, Peng still displays a large, framed black-and-white photograph of Kissinger and himself raising wineglasses at his restaurant, Peng's. "Kissinger visited us every time he was in New York," says Peng Chang-kuei, "and we became great friends. At that time, Hunanese food was unknown in the United States, and it wasn't until his cooking attracted the attention of officials at the nearby United Nations HQ, and especially of the American Secretary of State, Henry Kissinger, that he began to make his reputation. In 1973, Peng went to New York, where he opened his first restaurant on 44th Street. "General Tso's chicken did not preexist in Hunanese cuisine," he said, "but originally the flavors of the dish were typically Hunanese - heavy, sour, hot and salty." When I met Peng Chang-kuei, a tall, dignified man in his eighties, during a visit to Taipei in 2004, he could no longer remember exactly when he first cooked General Tso's chicken, although he says it was sometime in the 1950s. There, he continued to cater for official functions, devising menus for presidential feasts and visiting VIPs, and inventing many new dishes. By the end of World War II he was in charge of Nationalist government banquets, and when the Nationalists met their humiliating defeat at the hands of Mao Zedong's Communists in 1949, he fled with them to Taiwan. He worked in a period generally known as the golden age of Hunanese cooking, when the capital Changsha was the center of a flourishing culinary scene.Īfter his hard years of apprenticeship, Peng Chang-kuei won acclaim as a chef in his own right. Cao had previously served as private chef to the Nationalist official and great Hunanese gourmet Tan Yankai, and was one of the most outstanding cooks of his generation. As a teenager, he served as apprentice to Cao Jingchen, a famous chef who had just opened his own restaurant. Peng was born in 1919 into a poverty-stricken household in the Hunanese capital Changsha. They took with them many talented people from the mainland, including a number of notable chefs, and foremost among them was Peng Chang-kuei. The real roots of the dish lie in the chaotic aftermath of the Chinese civil war, when the leadership of the defeated Nationalist party fled to the island of Taiwan. But although many Chinese dishes are named after famous personages (like, for example, the Sichuanese Gong Bao Chicken), there is no record of any dish named after General Tso in the classic texts on Hunanese food and cooking. The Hunanese have a strong military tradition, and General Tso is one of their best-known historical figures. He led successful military campaigns against various rebel groups, but is best known for recapturing the great western desert region of Xinjiang from rebellious Uyghur Muslims. He was born in 1812 in Xiangyin county, Hunan province, and died in 1885 after a glittering career in the Qing dynasty civil and military administration. General Tso's chicken is named for Tso Tsung-t'ang (now usually transliterated as Zuo Zongtang), a formidable nineteenth-century general who is said to have enjoyed eating it. So how on Earth did this strange, foreign concoction come to be recognized abroad as the culinary classic of Hunan Province? And as I deepened my understanding of Hunanese food, I began to realize that General Tso's chicken was somewhat alien to the local palate, because Hunanese people have little interest in dishes that combine sweet and savory tastes. When I went to live there in 2003, I scoured restaurant menus for it in vain, and no one I met had ever heard of it. Despite its international reputation, however, the dish is virtually unknown in Hunan itself. A delectable concoction of lightly battered chicken in a chili-laced, sweet-sour sauce, it appears on restaurant menus across the world, but especially in the eastern United States, where it seems to have become the epitome of Hunanese cuisine. General Tso's (or Zuo's) chicken is the most famous Hunanese dish in the world. Can students install Office for iPad through Student Advantage Office 365 ProPlus?Ī. (Office Mobile applications are included with all Windows phones). Office 365 ProPlus is a user-based service and allows each student to install on up to five PCs or Macs, and five tablets and access Office mobile applications on iPhone and Android phones. Office 365 ProPlus comes with a full version of Office and familiar Office applications like Word, Excel, PowerPoint, Outlook, OneNote and more. If you have Office 365 Education at your school, you should make sure to transfer all your files from your school OneDrive to your personal OneDrive prior to graduation.Ī. You may enroll into other consumer or commercial offers available. When you graduate, your Office 365 subscription through your institution ends upon graduation. If you are running Mac OS X, then this screen may look differently than shown above, but you will still be able to load and install.Ī. Your Office 365 ProPlus experience will then begin. Simply select the appropriate language, and whether you want the 32-bit or 64-bit (click advanced to unlock that option) and then click install. This will take you to the page, below, where you can access your Office 365 ProPlus software: Type in your email address again and password then click on the Sign In button. Students will need to sign into Office 365 with their credentials here:Īs you tab to the Password field, you will be redirected to the OCCC login screen: You can download the free Office 365 software using the following steps. You can login using your OCCC username and password to download your free Office 365 ProPlus here. If you are a student, visit /GetOffice365 for more information and installation instructions. How do I get free Office 365 through the Student Advantage?Ī. The services include Office Online (Word, PowerPoint, Excel, and OneNote), 1TB of OneDrive storage, as well as the latest edition of the full Office software suite on up to 5 PCs or Macs for free. It’s available for free to active students at OCCC. Office 365 Education Student Advantage is a collection of services that allows you to collaborate and share your schoolwork. Women tend to stay more engaged in what’s happening in the world compared to their counterparts. The value of female perspectives is undeniable and has been proven time and time again. Women make up the majority of readers on social media and they are more likely than men to read blogs. However, when it comes to content, they represent a huge audience. Women are often seen as the minority in business and STEM fields. What is the Value of Female Perspectives? Supporting women in this field is going to be what brings in and creates the next generation of scientists who will be able to solve some of society's most pressing problems. There needs to be more empowerment for women in this field. Women are often underrepresented in the STEM fields and this needs to change. The representation and empowerment of women in STEM is important because it is one of the key factors that will determine the future of science. Why is Representation and Empowerment for Women in STEM is so Important? Women have played a significant role in many science discoveries, including discovering DNA's double helix structure, developing life-saving drugs, among many others. There’s still this bias that women can’t be good leaders, and this also gets in the way.ĭespite these challenges, women continue to be an important part of the STEM fields. They are often overlooked for leadership positions and promotions they have to deal with stereotypes and biases they are asked to do more menial tasks than men and they face sexual harassment from their colleagues. In the meantime, women are still facing many challenges in these fields. Women have been underrepresented in the STEM fields for decades. Even though there are women across the world leading the fight to change the world, why is it still so difficult for women to be seen as an equal? Challenges Women Face in Science and Technology Fields Unfortunately, it’s still difficult now more than ever for women to break into STEM. Innovation comes from having diverse groups of people work together, which leads to more creative solutions for problems and better collaborations for future projects. However, there is one main reason that diversity matters: innovation. It is important to have people with different backgrounds working on projects together because they can bring a new perspective and different ideas. There are many reasons why diversity matters and why it is so important to have more women in the STEM field. While you’ll see news and videos embracing women in STEM it’s still so difficult for women to get into these industries. In recent years, the STEM field has seen a decline in women. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |